Human Cells. Provides high level of assessment and understanding with review guides.
DNA - it is the repository of genetic information
RNA - it transcripts. it is the link between the gene and the gene product (protein)
Protein - are functional products. They are executors of cellular functions
The building blocks of any nucleic acid are the nucleotides.
A nucleotide is composed of a phosphate group (with negative charges), a sugar portion and an N-base.
The sugar in DNA is deoxyribose while the sugar in RNA is ribose.
DNA and RNA are polynucleotides. N-bases are either purines or pyrimidines.
Purine bases are Adenine (A) and Guanine (G).
Pyrimidines are Cytosine (C), Thymine (T, in DNA only) and Uracil (U, found only in RNA)
Specific base pairings occur in DNA. A pairs with T; G pairs with C
DNA is double stranded while RNA is single stranded with Uracil instead of Thymine.
Main Functions:
DNA: repository of genetic information; sequence of bases encodes the blueprint for life processes
RNA: information in the form of base sequence is transformed (transcribed) into mRNA, tRNA and rRNA. DNA is the template copied into RNA by base pairing. G with C; A with U.
Protein: functional products of genes; executes cellular functions
The four structural levels of proteins are:
1.Primary- sequence of amino acids in the polypeptide chain;
2. Secondary- when the polypeptide chains form a helix or a pleated sheet structure;
3. Tertiary- coiling of the polypeptide, combining helices and sheet forms;
4. Quaternary- the association of two or more polypeptides in space
Exercises :
REPLICATION :
A. Given the following coding sequence for DNA, provide the sequence of the complementary (template) sequence.
Coding sequence : 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
( Complete the Answer)
Complementary sequence 3’ TACGTATCTAATC______________________5’
TRANSCRIPTION :
B. Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding/ Template sequence 3’ TACGATCTAATCCTATAGGGTCTATC 5’
(Complete the Answer)
Coding sequence ~ mRNA transcript 5’ AUGCUAGAUUAG_____________________ 3’
Lesson 2 - BioMolecules : DNA Replication and Protein Synthesis
Lesson 3 - BioMolecules : Genetic Engineering
Lesson 4 - Biomolecules : Applications of Recombinant DNA
No comments:
Post a Comment