BioMolecules : DNA Replication and Protein Synthesis

Human Cells with a level of assessment for Laws. Just give the analysis of DNA, RNA and others.
1. DNA replication or DNA synthesis.
 DNA strands separate and serve as templates for the production of new DNA molecules.

     A. The following are features of replication:
          i. Semiconservative- the resulting DNA consists of one old and one new strand
          ii. Base pairing is maintained; Adenine pairs with Thymine, Guanine pairs with Cytosine
          iii. New DNA molecules are produced in the 5’ to 3’ direction
          iv. Semi discontinuous. The leading strand is synthesized in a continuous manner (5’ to 3’) while the lagging strand is produced discontinuously in short stretches called Okazaki fragments.

     B. In lagging strand synthesis, there is a need for a primer terminus which is provided by an RNA molecule. RNA is synthesized by a primase or RNA polymerase. The 3’OH of the RNA is where new DNA nucleotides are added thus new DNA is built in the 5’ to 3’ direction.

     C. Enzymes in replication are as follows:
         1. helicase;
         2. gyrase;
         3. SSB (single strand binding proteins);
         4. primase or RNA polymerase;
         5. DNA polymerase and
         6. DNA ligase.

2. Transcription or RNA synthesis.

DNA is unwound and one strand is used as template for the production of an RNA molecule.
An RNA polymerase makes RNA in the 5’ to 3’ direction.

Specific regions in the DNA called promoters allow the binding of transcription factors which make possible the binding of RNA polymerase.

Three major types of RNA are: messenger RNA (mRNA); transfer RNA (tRNA) and ribosomal RNA (rRNA).

3. Translation or protein synthesis.

This occurs in the ribosome. Basic ingredients are the various types of RNAs produced in transcription and some proteins or enzymes. The mRNA contains triplets of bases called codons that specify an amino acid, eg. UUU-phe. Various tRNAs carry amino acids from the cytoplasm to the actual site of translation in the ribosome. A tRNA has an anticodon that pair with a codon in the mRNA. Different rRNAs combine with ribosomal proteins to make up the subunits of a ribosome. A functional ribosome has a small and a large subunit.

In bacteria, transcription and translation may be simultaneous. In eukaryotic cells, mRNA, tRNA and rRNA travel from the nucleus to the cytoplasm through the nuclear pores. RNAs may undergo processing. Some unnecessary parts like introns are removed. In eukaryotic mRNA, a 5’ cap and a 3’ poly A tail are added. Coding regions of mRNA are called exons. They specify functional protein products.

The genetic code is the correspondence of the mRNA codons to amino acids.

An amino acid is specified by a codon with three code letters. The genetic code is shown as follows:

Here is a 3D animation that shows how proteins are made in the cell from the information in the DNA code.



Practice Exercises :

REPLICATION :

A. Given the following coding sequence for DNA, provide the sequence of the complementary (template) sequence.

Coding sequence : 5’GATTAGGAATGTATGACTACAGATACGTA 3’

( Complete the Answer)
Complementary sequence 3’ CTAA_______________________________________5’

TRANSCRIPTION :

B. Convert the given coding sequence into an mRNA transcript:

Complementary Non-coding/ Template sequence 3’ CAGTATACGATCGTAGACTATGCTGC 5’

(Complete the Answer) 
Coding sequence ~ mRNA transcript 5’ GUC_______________________________ 3’

TRANSLATION :

C. Translate the given mRNA transcript into a polypeptide sequence:

Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’

(Complete the Answer)
Polypeptide sequence N - Met - His -___- Leu -___- Tyr -___- Arg - C

Lesson 1 - BioMolecules : Structure and Functions
Lesson 3 - BioMolecules : Genetic Engineering 
Lesson 4 - Biomolecules : Applications of Recombinant DNA